Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Lp_PK4

PKB-number: PKB70
Definition: Pseudoknot PK4 of Legionella pneumophila tmRNA
Organism: Legionella pneumophila
Abbreviation: Lp_PK4
RNA type: tmRNA
Keywords: trans-translation; peptide tagging; tmRNA
EMBL number: U68079
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Williams K.P. & Bartel D.P. (1996). RNA 2:1306-1310.
[2] Williams K.P. (2000). Nucleic Acids Res. 28:168. (The tmRNA Website: http://www.indiana.edu/~tmrna/).
[3] Zwieb C. & Wower J. (2000). Nucleic Acids Res. 28:169-170. (tmRNA database: http://psyche.uthct.edu/dbs/tmRDB/tmRDB.html).
Stem sizes:
Loop sizes:
11 6
1 0 11
Position Paired:
289-294; 319-324
297-298; 315-316
300-302; 311-313
304-306; 341-343
308-310; 336-338
Bracket view of structure:
          290       300       310       320       330       340
     #     9|123456789|123456789|123456789|123456789|123456789|123
     $ 289 GCUGUGUAUCAUCCUGCCCGUCGGAGGAGCCACAGUUAAAUUCAAAAGACAAGGC=343
     % 289 ((((((::((:(((:[[[:[[[))):))::)))))):::::::::::]]]::]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-8/.../1999-12-23 PKB00070.html