Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Ec_alpha

PKB-number: PKB71
Definition: Pseudoknot of the regulatory region of the alpha ribosomal protein operon
Organism: E.coli
Abbreviation: Ec_alpha
RNA type: mRNA
Keywords: translation; double pseudoknot
EMBL number: X02543
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; calorimetry, UV hyperchromicity
References: [1] Tang C.K. & Draper D.E. (1989). Cell 57:531-536.
[2] Gluick T.C. & Draper D.E. (1994). J. Mol. Biol. 241:246-262.
[3] Gluick T.C. et al. (1997). J. Mol. Biol. 270:451-463.
Stem sizes:
Loop sizes:
12 8 4
8 4 1 26 11
Position Paired:
144-150; 191-197
152-156; 186-190
165-168; 233-236
173-176; 224-227
181-184; 248-251
Bracket view of structure:
                 150       160       170       180       190       200
      #      456789|123456789|123456789|123456789|123456789|123456789|123
      $  144 UGUGCGUUUCCAUUUGAGUAUCCUGAAAACGGGCUUUUCAGCAUGGAACGUACAUAUUAA=203
      %  144 (((((((:(((((::::::::[[[[::::[[[[::::{{{{:))))))))))))::::::
                 210       220       230       240       250
      #      456789|123456789|123456789|123456789|123456789|1
      $  204 AUAGUAGGAGUGCAUAGUGGCCCGUAUAGCAGGCAUUAACAUUCCUGA=251
      %  204 ::::::::::::::::::::]]]]:::::]]]]:::::::::::}}}}

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-10-1 PKB00071.html