Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Ec_S15

PKB-number: PKB72
Definition: Pseudoknot of the regulatory region of S15 ribosomal protein mRNA
Organism: E.coli
Abbreviation: Ec_S15
RNA type: mRNA
Keywords: translation;
EMBL number: J02638
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Structure probing; 3D-modelling
References: [1] Philippe C. et al. (1995). Nucleic Acids Res. 23:18-28.
Stem sizes:
Loop sizes:
10 7
1 0 31
Position Paired:
91-94; 116-119
96-101; 110-115
103-109; 151-157
Bracket view of structure:
                 100       110       120       130       140       150
     #    123456789|123456789|123456789|123456789|123456789|123456789|1234567
     $ 91 GGGAUCGCUGAAUUAGAGAUCGGCGUCCUUUCAUUCUAUAUACUUUGGAGUUUUAAAAUGUCUCUAA=157
     % 91 ((((:((((((:[[[[[[[)))))))))):::::::::::::::::::::::::::::::]]]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-9 PKB00072.html