Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
T2_gene32

PKB-number: PKB73
Definition: Pseudoknot of the regulatory region of bacteriophage T2 gene 32 mRNA
Organism: T2 bacteriophage
Abbreviation: T2_gene32
RNA type: mRNA
Keywords: autoregulation; bacteriophage
EMBL number: X12460
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; NMR; Sequence comparison; UV-hyperchromicity
References: [1] Du Z. et al. (1996). Biochemistry 35:4187-4198.
[2] Du Z. & Hoffman D.W. (1997). Nucleic Acids Res. 25:1130-1135.
[3] Nixon P.L. & Giedroc D.P. (1998). Biochemistry 37:16116-16129.
Comment: The identical pseudoknot is folded in the regulatory region of T6 bacteriophage gene 32 mRNA [2].
Stem sizes:
Loop sizes:
5 7
1 0 7
Position Paired:
2-6; 15-19
8-14; 27-33
Bracket view of structure:
                 10        20        30
     #   123456789|123456789|123456789|123
     $ 1 CUGACCAGCUAUGAGGUCAUACAUCGUCAUAGC=33
     % 1 :(((((:[[[[[[[))))):::::::]]]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-9 PKB00073.html