Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
T4_gene32

PKB-number: PKB74
Definition: Pseudoknot of the regulatory region of T4 bacteriophage gene 32 mRNA
Organism: bacteriophage T4
Abbreviation: T4_gene32
RNA type: mRNA
Keywords: autoregulation; bacteriophage
EMBL number: J02513
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; NMR; Sequence comparison; Structure probing; UV-hyperchromicity
References: [1] Qiu H. et al. (1996). Biochemistry 35:4176-4186.
[2] Theimer C.A. et al. (1998). J. Mol. Biol. 279:545-564.
Stem sizes:
Loop sizes:
4 7
1 0 5
Position Paired:
277-280; 289-292
282-288; 298-304
Bracket view of structure:
            280       290       300
     #     789|123456789|123456789|1234
     $ 277 UGCCAGCUAUGAGGUAAAGUGUCAUAGC=304
     % 277 ((((:[[[[[[[)))):::::]]]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-9 PKB00074.html