| Intro | |||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
| HDV-It_g | |||||
| PKB-number: | PKB75 |
| Definition: | Delta ribozyme (genomic) |
| Organism: | hepatitis delta virus ("Italy" variant) |
| Abbreviation: | HDV-It_g |
| RNA type: | Ribozymes |
| Keywords: | self-cleavage; double pseudoknot; |
| EMBL number: | X04451 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Crystal structure; Mutagenesis; Sequence comparison; Structure probing |
| References: |
[1] Been M.D. & Wickham G.S. (1997). Eur. J. Biochem. 247:741-753.
[2] Ferre-D'Amare A.R., Zhou K. & Doudna J.A. (1998). Nature 395:567-574. [3] Lafontaine D.A. et al. (1999). Nucleic Acids Res. 27:186-187. (database: http://www.callisto.si.usherb.ca/~jpperra). |
| Comment: | Delta ribozyme is a catalytic self-cleaving structure, folded in both genomic and antigenomic RNAs of hepatitis delta virus. For review, see e.g.[1]. The pairing 706-707/723-724 was found in the crystal structure [2]. The sequence and numbering corresponds to "Italy" variant. For the compilation of HDV sequences, see [3]. The cleavage site is between nucleotide positions 685-686. |
| Stem sizes: Loop sizes: |
7 7 3 2 2 0 1 5 0 0 39 |
| Position Paired: | 686-692; 716-722 695-701; 764-770 702-704; 713-715 729-732; 755-758 733-741; 745-753 706-707; 723-724 |
| Bracket view of structure: |
690 700 710 720 730 740
# 56789|123456789|123456789|123456789|123456789|123456789|1234
$ 685 UGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUUCCGAGGGGACCG=744
% 685 :(((((((::[[[[[[[{{{:[[:::::}}})))))))]]::::(((((((((((((:::
750 760 770
# 56789|123456789|123456789|12
$ 745 UCCCCUCGGUAAUGGCGAAUGGGACCCA=772
% 745 ))))))))):)))):::::]]]]]]]::