Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
HDV-It_g

PKB-number: PKB75
Definition: Delta ribozyme (genomic)
Organism: hepatitis delta virus ("Italy" variant)
Abbreviation: HDV-It_g
RNA type: Ribozymes
Keywords: self-cleavage; double pseudoknot;
EMBL number: X04451
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Crystal structure; Mutagenesis; Sequence comparison; Structure probing
References: [1] Been M.D. & Wickham G.S. (1997). Eur. J. Biochem. 247:741-753.
[2] Ferre-D'Amare A.R., Zhou K. & Doudna J.A. (1998). Nature 395:567-574.
[3] Lafontaine D.A. et al. (1999). Nucleic Acids Res. 27:186-187. (database: http://www.callisto.si.usherb.ca/~jpperra).
Comment: Delta ribozyme is a catalytic self-cleaving structure, folded in both genomic and antigenomic RNAs of hepatitis delta virus. For review, see e.g.[1]. The pairing 706-707/723-724 was found in the crystal structure [2]. The sequence and numbering corresponds to "Italy" variant. For the compilation of HDV sequences, see [3]. The cleavage site is between nucleotide positions 685-686.
Stem sizes:
Loop sizes:
7 7 3 2
2 0 1 5 0 0 39
Position Paired:
686-692; 716-722
695-701; 764-770
702-704; 713-715
729-732; 755-758
733-741; 745-753
706-707; 723-724
Bracket view of structure:
                690       700       710       720       730       740
      #      56789|123456789|123456789|123456789|123456789|123456789|1234
      $  685 UGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUUCCGAGGGGACCG=744
      %  685 :(((((((::[[[[[[[{{{:[[:::::}}})))))))]]::::(((((((((((((:::
                750       760       770
      #      56789|123456789|123456789|12
      $  745 UCCCCUCGGUAAUGGCGAAUGGGACCCA=772
      %  745 ))))))))):)))):::::]]]]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-16 PKB00075.html