Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
HDV-It_ag

PKB-number: PKB76
Definition: Delta ribozyme (antigenomic)
Organism: hepatitis delta virus ("Italy" variant)
Abbreviation: HDV-It_ag
RNA type: Ribozymes
Keywords: self-cleavage; double pseudoknot
EMBL number: X04451
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison; Structure probing
References: [1] Been M.D. & Wickham G.S. (1997). Eur. J. Biochem. 247:741-753.
[2] Lafontaine D.A. et al. (1999). Nucleic Acids Res. 27:186-187.
Comment: Delta ribozyme is a catalytic self-cleaving structure, folded in both genomic and antigenomic RNAs of hepatitis delta virus. For review, see e.g.[1]. For the compilation of HDV sequences, see [2]. The sequence is shown for "Italy" variant, the numbering starts downstream of the cleavage site (positions 901/900) at nucleotide 900, thus the 3'-proximal nucleotide 89 corresponds to position 812 in the genomic RNA.
Stem sizes:
Loop sizes:
7 4
8 13 41
Position Paired:
1-7; 33-39
16-19; 81-84
20-22; 30-32
43-49; 68-74
54-57; 62-65
Bracket view of structure:
                   10        20        30        40        50        60
      #    123456789|123456789|123456789|123456789|123456789|123456789|
      $  1 GGGUCGGCAUGGCAUCUCCACCUCCUCGCGGUCCGACCUGGGCAUCCGAAGGAGGACGCA=60
      %  1 (((((((::::::::[[[[(((:::::::)))))))))):::(((((((::::((((:::
                    70        80
      #     123456789|123456789|123456789
      $  61 CGUCCACUCGGAUGGCUAAGGGAGAGCCA=89
      %  61 :))))::)))))))::::::]]]]:::::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-16 PKB00076.html