Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
oligo_PK5

PKB-number: PKB81
Definition: Oligonucleotide PK5
Organism:
Abbreviation: oligo_PK5
RNA type: Artificial molecule
Keywords: NMR; folding kinetics
EMBL number:
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: NMR; Structure probing; UV hyperchromicity
References: [1] Puglisi J.D., Wyatt J.R. & Tinoco I. (1990). J. Mol. Biol. 214:437-453.
[2] Wyatt J.R., Puglisi J.D. & Tinoco I. (1990). J. Mol. Biol. 214:455-470.
Stem sizes:
Loop sizes:
3 5
4 0 6
Position Paired:
1-3; 13-15
8-12; 22-26
Bracket view of structure:
                 10        20
     #   123456789|123456789|123456
     $ 1 GCGAUUUCUGACCGCUUUUUUGUCAG=26
     % 1 (((::::[[[[[)))::::::]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-16 PKB00081.html