Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMV-L_UPD-PK1

PKB-number: PKB82
Definition: Pseudoknot PK1 of the upstream pseudoknot domain (UPD) of the 3'-UTR of the tomato strain of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: TMV-L_UPD-PK1
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: X02144
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
Stem sizes:
Loop sizes:
3 4
3 0 6
Position Paired:
6203-6205; 6213-6215
6209-6212; 6222-6225
Bracket view of structure:
                  6210      6220
     #      123456789|123456789|123456
     $ 6201 AUAAAGUUUGUGUUUCUAAAACACAC=6226
     % 6201 ::(((:::[[[[)))::::::]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-16 PKB00082.html