Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMV-L_UPD-PK3

PKB-number: PKB84
Definition: Pseudoknot PK3 of the upstream pseudoknot domain (UPD) of the 3'-UTR of the tomato strain of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: TMV-L_UPD-PK3
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: X02144
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
Stem sizes:
Loop sizes:
4 5
5 0 6
Position Paired:
6248-6251; 6262-6265
6257-6260; 6274-6277
6261-6261; 6272-6272
Bracket view of structure:
            6250      6260      6270
     #      789|123456789|123456789|12345678
     $ 6247 CAGUGUUUUUCCCUCCACUUAAAUCGAAGGGU=6278
     % 6247 :((((:::::[[[[[))))::::::]:]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-16 PKB00084.html