Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CcTMV_UPD-PK1

PKB-number: PKB85
Definition: Pseudoknot PK1 of the upstream pseudoknot domain (UPD) of the 3'-UTR of the cowpea strain of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: CcTMV_UPD-PK1
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: J02413
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
Comment: This virus is also called sunhemp mosaic virus (SHMV).
Stem sizes:
Loop sizes:
3 6
2 0 2
Position Paired:
1603-1605; 1614-1616
1608-1613; 1619-1624
Bracket view of structure:
                 1610      1620
     #      23456789|123456789|12345
     $ 1602 AAGUUUGGUCGUACUUAACGACCU=1625
     % 1602 :(((::[[[[[[)))::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-16 PKB00085.html