Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CcTMV_UPD-PK3

PKB-number: PKB87
Definition: Pseudoknot PK3 of the upstream pseudoknot domain (UPD) of the 3'-UTR of the cowpea strain of tobacco mosaic virus
Organism: tobacco mosaic virus
Abbreviation: CcTMV_UPD-PK3
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: J02413
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
Comment: This virus is also called sunhemp mosaic virus (SHMV).
Stem sizes:
Loop sizes:
4 5
5 0 6
Position Paired:
1646-1649; 1660-1663
1655-1658; 1672-1675
1659-1659; 1670-1670
Bracket view of structure:
              1650      1660      1670
     #      56789|123456789|123456789|123456
     $ 1645 CCGUGUUUAAGAGUCCACGCAAAUCGAACUCU=1676
     % 1645 :((((:::::[[[[[))))::::::]:]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-16 PKB00087.html