Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CGMMV_UPD-PK2

PKB-number: PKB90
Definition: Pseudoknot PK2 of the upstream pseudoknot domain (UPD) of the 3'-UTR of cucumber green mottle mosaic virus
Organism: cucumber green mottle mosaic virus
Abbreviation: CGMMV_UPD-PK2
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: D12505
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
6267-6269; 6277-6279
6271-6276; 6283-6288
Bracket view of structure:
             6270      6280
     #      6789|123456789|123456789
     $ 6266 UGGUGGUGCACACCAAAGUGCAUA=6289
     % 6266 :(((:[[[[[[))):::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-16 PKB00090.html