Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CGMMV_UPD-PK3

PKB-number: PKB91
Definition: Pseudoknot PK3 of the upstream pseudoknot domain (UPD) of the 3'-UTR of cucumber green mottle mosaic virus
Organism: cucumber green mottle mosaic virus
Abbreviation: CGMMV_UPD-PK3
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: D12505
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] van Belkum A. et al. (1985). Nucleic Acids Res. 13:7673-7686.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
Stem sizes:
Loop sizes:
4 5
5 0 6
Position Paired:
6289-6292; 6303-6306
6298-6301; 6315-6318
6302-6302; 6313-6313
Bracket view of structure:
           6290      6300      6310      6320
     #      89|123456789|123456789|123456789|
     $ 6288 UAGUGCUUUCCCGUUCACUUAAAUCGAACGGUU=6320
     % 6288 :((((:::::[[[[[))))::::::]:]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-16 PKB00091.html