Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMGMV_UPD-PK1

PKB-number: PKB92
Definition: Pseudoknot PK1 of the upstream pseudoknot domain (UPD) of the 3'-UTR of tobacco mild green mosaic virus
Organism: tobacco mild green mosaic virus
Abbreviation: TMGMV_UPD-PK1
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: M34077
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
Stem sizes:
Loop sizes:
5 5
1 0 4
Position Paired:
6172-6176; 6183-6187
6178-6182; 6192-6196
Bracket view of structure:
                  6180      6190
     #      123456789|123456789|1234567
     $ 6171 AAAGUCGCUGAAGACUUAAAAUUCAGG=6197
     % 6171 :(((((:[[[[[)))))::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-16 PKB00092.html