Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMGMV_UPD-PK3

PKB-number: PKB94
Definition: Pseudoknot PK3 of the upstream pseudoknot domain (UPD) of the 3'-UTR of tobacco mild green mosaic virus
Organism: tobacco mild green mosaic virus
Abbreviation: TMGMV_UPD-PK3
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: M34077
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
Stem sizes:
Loop sizes:
4 4
5 1 8
Position Paired:
6219-6222; 6233-6236
6228-6231; 6245-6248
Bracket view of structure:
           6220      6230      6240      6250
     #      89|123456789|123456789|123456789|
     $ 6218 CAGUGGUUGUUCGUCCACUUAAAUAUAACGAUU=6250
     % 6218 :((((:::::[[[[:))))::::::::]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-16 PKB00094.html