Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
PMMV-S_UPD-PK3

PKB-number: PKB97
Definition: Pseudoknot PK3 of the upstream pseudoknot domain (UPD) of the 3'-UTR of pepper mild mottle virus, Spanish isolate
Organism: pepper mild mottle virus
Abbreviation: PMMV-S_UPD-PK3
RNA type: Viral 3 UTR
Keywords: tobamovirus; translational regulation
EMBL number: M81413
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Avila-Rincon M.J. et al. (1989). J. Gen. Virol. 70:3025-3031.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
Stem sizes:
Loop sizes:
4 5
5 0 6
Position Paired:
6220-6223; 6234-6237
6229-6232; 6246-6249
6233-6233; 6244-6244
Bracket view of structure:
          6220      6230      6240      6250
     #      9|123456789|123456789|123456789|
     $ 6219 UAGUGUUUUUCCCUCCACUUAAAUCGAAGGGU=6250
     % 6219 :((((:::::[[[[[))))::::::]:]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-16 PKB00097.html