Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
STMV_UPD2-PK1

PKB-number: PKB100
Definition: Pseudoknot PK1 of the upstream pseudoknot domain (UPD2) of the 3'-UTR of satellite tobacco mosaic virus
Organism: satellite tobacco mosaic virus
Abbreviation: STMV_UPD2-PK1
RNA type: Viral 3 UTR
Keywords: tobamovirus; satellite virus; translational regulation
EMBL number: M25782
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
[2] Gultyaev A.P. et al. (1994). J. Gen. Virol. 75:2851-2856.
[3] Felden B. et al. (1994). Nucleic Acids Res. 22:2882-2886.
Comment: The relatively long 3'-UTR of STMV RNA is predicted to have two upstream pseudoknot domains (UPD). The UPD1 is located just upstream of 3'-terminal tRNA-like structure, similar to structures in helper viruses [1-3], the UPD2 is in the 5'-proximal part of the 3'-UTR [2].
Stem sizes:
Loop sizes:
6 6
2 0 3
Position Paired:
653-658; 667-672
661-666; 676-681
Bracket view of structure:
                 660       670       680
     #     23456789|123456789|123456789|12
     $ 652 AAGCCUUUUGGAUCGAAGGUUAAACGAUCCG=682
     % 652 :((((((::[[[[[[)))))):::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-18 PKB00100.html