Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
STMV_UPD1-PK1

PKB-number: PKB103
Definition: Pseudoknot PK1 of the upstream pseudoknot domain (UPD1) of the 3'-UTR of satellite tobacco mosaic virus
Organism: satellite tobacco mosaic virus
Abbreviation: STMV_UPD1-PK1
RNA type: Viral 3 UTR
Keywords: tobamovirus; satellite virus; translational regulation
EMBL number: M25782
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
[2] Gultyaev A.P. et al. (1994). J. Gen. Virol. 75:2851-2856.
[3] Felden B. et al. (1994). Nucleic Acids Res. 22:2882-2886.
Comment: The relatively long 3'-UTR of STMV RNA is predicted to have two upstream pseudoknot domains (UPD). The UPD1 is located just upstream of the 3'-terminal tRNA-like structure, similar to structures in helper viruses [1-3], the UPD2 is in the 5'-proximal part of the 3'-UTR [2].
Stem sizes:
Loop sizes:
3 4
1 0 8
Position Paired:
873-875; 881-883
877-880; 892-895
Bracket view of structure:
                 880       890
     #     23456789|123456789|123456
     $ 872 CGCCGACGUGGCUGUAUAAUACGUC=896
     % 872 :(((:[[[[)))::::::::]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-18 PKB00103.html