Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
T.the_telo

PKB-number: PKB108
Definition: Pseudoknot of telomerase RNA of T.thermophila
Organism: Tetrahymena thermophila
Abbreviation: T.the_telo
RNA type: Others
Keywords: Ciliophora; ribonucleoprotein; telomerase
EMBL number:
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; Structure probing
References: [1] ten Dam E. et al. (1991). Nucleic Acids Res. 19:6951.
[2] Lingner J. et al. (1994). Genes & Development 8:1984-1998.
[3] McCormick-Graham M. & Romero D.P. (1995). Nucleic Acids Res. 23:1091-1097.
[4] Zaug A.J. & Cech T.R. (1995). RNA 1:363-374.
Stem sizes:
Loop sizes:
4 8
3 0 4
Position Paired:
69-72; 84-87
76-83; 92-99
Bracket view of structure:
             70        80        90       100
     #    6789|123456789|123456789|123456789|
     $ 66 UAUAACCUUCACCAAUUAGGUUCAAAUAAGUGGUA=100
     % 66 :::((((:::[[[[[[[[))))::::]]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-22 PKB00108.html