Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BVQ1_UPD-PKc

PKB-number: PKB109
Definition: Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet virus Q RNA 1
Organism: beet virus Q
Abbreviation: BVQ1_UPD-PKc
RNA type: Viral 3 UTR
Keywords: pomovirus
EMBL number: AJ223596
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036.
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
5804-5806; 5814-5816
5808-5813; 5820-5825
Bracket view of structure:
                5810      5820
     #      3456789|123456789|123456
     $ 5803 UUGUGGUGCAUACAAUAAUGCAUA=5826
     % 5803 :(((:[[[[[[))):::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-22 PKB00109.html