Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BVQ1_UPD-PKb

PKB-number: PKB110
Definition: Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet virus Q RNA 1
Organism: beet virus Q
Abbreviation: BVQ1_UPD-PKb
RNA type: Viral 3 UTR
Keywords: pomovirus
EMBL number: AJ223596
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036.
Stem sizes:
Loop sizes:
4 6
4 0 6
Position Paired:
5826-5829; 5840-5843
5834-5838; 5852-5856
5839-5839; 5850-5850
Bracket view of structure:
              5830      5840      5850
     #      56789|123456789|123456789|1234567
     $ 5825 UAGUGUUUGCCGUUCCACUUAAAUCGAAACGGA=5857
     % 5825 :((((::::[[[[[[))))::::::]:]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-23 PKB00110.html
PKB00110.html