Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BVQ2_UPD-PKc

PKB-number: PKB111
Definition: Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet virus Q RNA 2
Organism: beet virus Q
Abbreviation: BVQ2_UPD-PKc
RNA type: Viral 3 UTR
Keywords: pomovirus
EMBL number: AJ223597
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036.
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
2715-2717; 2725-2727
2719-2724; 2731-2736
Bracket view of structure:
               2720      2730
     #      456789|123456789|1234567
     $ 2714 ACGUGGUGCAUACGUUAAUGCAUA=2737
     % 2714 :(((:[[[[[[))):::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-23 PKB00111.html