Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BVQ2_UPD-PKb

PKB-number: PKB112
Definition: Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet virus Q RNA 2
Organism: beet virus Q
Abbreviation: BVQ2_UPD-PKb
RNA type: Viral 3 UTR
Keywords: pomovirus
EMBL number: AJ223597
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036.
Stem sizes:
Loop sizes:
4 6
4 0 6
Position Paired:
2737-2740; 2751-2754
2745-2749; 2763-2767
2750-2750; 2761-2761
Bracket view of structure:
             2740      2750      2760
     #      6789|123456789|123456789|12345678
     $ 2736 UAGUGUUUUUCGUUCCACUUAAAUCGAAACGAU=2768
     % 2736 :((((::::[[[[[[))))::::::]:]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-23 PKB00112.html