Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BVQ3_UPD-PKc

PKB-number: PKB113
Definition: Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet virus Q RNA 3
Organism: beet virus Q
Abbreviation: BVQ3_UPD-PKc
RNA type: Viral 3 UTR
Keywords: pomovirus
EMBL number: AJ223598
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036.
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
2329-2331; 2339-2341
2333-2338; 2345-2350
Bracket view of structure:
           2330      2340      2350
     #      89|123456789|123456789|1
     $ 2328 UCGUGGUGCAUACGAAAAUGCAUA=2351
     % 2328 :(((:[[[[[[))):::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-23 PKB00113.html