Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BVQ3_UPD-PKb

PKB-number: PKB114
Definition: Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet virus Q RNA 3
Organism: beet virus Q
Abbreviation: BVQ3_UPD-PKb
RNA type: Viral 3 UTR
Keywords: pomovirus
EMBL number: AJ223598
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036.
Stem sizes:
Loop sizes:
4 6
4 0 6
Position Paired:
2351-2354; 2365-2368
2359-2363; 2377-2381
2364-2364; 2375-2375
Bracket view of structure:
         2350      2360      2370      2380
     #      |123456789|123456789|123456789|12
     $ 2350 UAGUGUUUACCGUUCCACUUAAAUCGAAACGGA=2382
     % 2350 :((((::::[[[[[[))))::::::]:]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-23 PKB00114.html