Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BSBV1_UPD-PKc

PKB-number: PKB115
Definition: Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet soil-borne virus RNA1
Organism: beet soil-borne virus
Abbreviation: BSBV1_UPD-PKc
RNA type: Viral 3 UTR
Keywords: furovirus; pomovirus
EMBL number: Z97873
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036.
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
5637-5639; 5647-5649
5641-5646; 5653-5658
Bracket view of structure:
             5640      5650
     #      6789|123456789|123456789
     $ 5636 CGGUAGCGCGAACCUUAUCGCGCA=5659
     % 5636 :(((:[[[[[[))):::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-23 PKB00115.html