Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BSBV1_UPD-PKb

PKB-number: PKB116
Definition: Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet soil-borne virus RNA 1
Organism: beet soil-borne virus
Abbreviation: BSBV1_UPD-PKb
RNA type: Viral 3 UTR
Keywords: furovirus; pomovirus
EMBL number: Z97873
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036.
Stem sizes:
Loop sizes:
4 6
4 0 6
Position Paired:
5659-5662; 5673-5676
5667-5671; 5685-5689
5672-5672; 5683-5683
Bracket view of structure:
           5660      5670      5680      5690
     #      89|123456789|123456789|123456789|
     $ 5658 CAGUGUUUUGAAGUCCACUUAAAUAGAACUUCU=5690
     % 5658 :((((::::[[[[[[))))::::::]:]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-23 PKB00116.html