Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BSBV2_UPD-PKc

PKB-number: PKB117
Definition: Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet soil-borne virus RNA 2
Organism: beet soil-borne virus
Abbreviation: BSBV2_UPD-PKc
RNA type: Viral 3 UTR
Keywords: furovirus; pomovirus
EMBL number: U64512
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036.
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
3254-3256; 3264-3266
3258-3263; 3270-3275
Bracket view of structure:
                3260      3270
     #      3456789|123456789|123456
     $ 3253 ACGUGGGUUAUACGAUAAUAACCG=3276
     % 3253 :(((:[[[[[[))):::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-23 PKB00117.html