Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BSBV2_UPD-PKb

PKB-number: PKB118
Definition: Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet soil-borne virus RNA 2
Organism: beet soil-borne virus
Abbreviation: BSBV2_UPD-PKb
RNA type: Viral 3 UTR
Keywords: furovirus; pomovirus
EMBL number: U64512
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036.
Stem sizes:
Loop sizes:
4 6
4 0 6
Position Paired:
3276-3279; 3290-3293
3284-3288; 3302-3306
3289-3289; 3300-3300
Bracket view of structure:
              3280      3290      3300
     #      56789|123456789|123456789|1234567
     $ 3275 CGGUGCUUUUAUGUUCACCGAAAUCGAACAUAC=3307
     % 3275 :((((::::[[[[[[))))::::::]:]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-23 PKB00118.html