Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BSBV3_UPD-PKc

PKB-number: PKB119
Definition: Pseudoknot PKc of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet soil-borne virus RNA 3
Organism: beet soil-borne virus
Abbreviation: BSBV3_UPD-PKc
RNA type: Viral 3 UTR
Keywords: furovirus; pomovirus
EMBL number: Z66493
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036.
Stem sizes:
Loop sizes:
3 6
1 0 3
Position Paired:
2807-2809; 2817-2819
2811-2816; 2823-2828
Bracket view of structure:
             2810      2820
     #      6789|123456789|123456789
     $ 2806 ACGUGGCGAAUACGAUAAUUCGUA=2829
     % 2806 :(((:[[[[[[))):::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-23 PKB00119.html