Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BSBV3_UPD-PKb

PKB-number: PKB120
Definition: Pseudoknot PKb of the upstream pseudoknot domain (UPD) of the 3'-UTR of beet soil-borne virus RNA 3
Organism: beet soil-borne virus
Abbreviation: BSBV3_UPD-PKb
RNA type: Viral 3 UTR
Keywords: furovirus; pomovirus
EMBL number: Z66493
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Koenig R. et al. (1998). J. Gen. Virol. 79:2027-2036.
Stem sizes:
Loop sizes:
6 6
1 0 9
Position Paired:
2829-2834; 2842-2847
2836-2841; 2857-2862
Bracket view of structure:
           2830      2840      2850      2860
     #      89|123456789|123456789|123456789|123
     $ 2828 UAGUGUUCGUGGAUAACACUUUAAUUAAGAUUCAUA=2863
     % 2828 :((((((:[[[[[[)))))):::::::::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-23 PKB00120.html