Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
STNV1_PK1

PKB-number: PKB121
Definition: Pseudoknot PK1 of the 3'-UTR of satellite tobacco necrosis virus 1
Organism: satellite tobacco necrosis virus 1
Abbreviation: STNV1_PK1
RNA type: Viral 3 UTR
Keywords: necrovirus; satellite virus; translational regulation
EMBL number: J02399
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Danthinne X. et al. (1991). Virology 185:605-614.
Stem sizes:
Loop sizes:
3 5
2 0 6
Position Paired:
732-734; 742-744
737-741; 751-755
Bracket view of structure:
                  740       750
     #     123456789|123456789|123456
     $ 731 AAGCAGUCCCAGCUCUGCAUUGGGAA=756
     % 731 :(((::[[[[[)))::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-24 PKB00121.html