Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
STNV1_PK2

PKB-number: PKB122
Definition: Pseudoknot PK2 of the 3'-UTR of satellite tobacco necrosis virus 1
Organism: satellite tobacco necrosis virus 1
Abbreviation: STNV1_PK2
RNA type: Viral 3 UTR
Keywords: necrovirus; satellite virus; translational regulation
EMBL number: J02399
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Danthinne X. et al. (1991). Virology 185:605-614.
Stem sizes:
Loop sizes:
5 7
3 0 2
Position Paired:
788-792; 803-807
796-802; 810-816
Bracket view of structure:
            790       800       810
     #     789|123456789|123456789|1234567
     $ 787 UACUACUUGCUCAUUUGUAGUCUAAAUGAGA=817
     % 787 :(((((:::[[[[[[[)))))::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-24 PKB00122.html