Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
STNV1_PK3

PKB-number: PKB123
Definition: Pseudoknot PK3 of the 3'-UTR of satellite tobacco necrosis virus 1
Organism: satellite tobacco necrosis virus 1
Abbreviation: STNV1_PK3
RNA type: Viral 3 UTR
Keywords: necrovirus; satellite virus; translational regulation
EMBL number: J02399
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Danthinne X. et al. (1991). Virology 185:605-614.
Stem sizes:
Loop sizes:
4 6
2 0 2
Position Paired:
817-820; 829-832
823-828; 835-840
Bracket view of structure:
             820       830       840
     #     6789|123456789|123456789|1
     $ 816 GACGUUGGCCUCGACGUGUCGAGGUG=841
     % 816 :((((::[[[[[[))))::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-24 PKB00123.html