Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
STNV2_PK1

PKB-number: PKB124
Definition: Pseudoknot PK1 of the 3'-UTR of satellite tobacco necrosis virus 2
Organism: satellite tobacco necrosis virus 2
Abbreviation: STNV2_PK1
RNA type: Viral 3 UTR
Keywords: necrovirus; satellite virus; translational regulation
EMBL number: M64479
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Danthinne X. et al. (1991). Virology 185:605-614.
Stem sizes:
Loop sizes:
3 7
1 0 6
Position Paired:
738-740; 749-751
742-748; 758-764
Bracket view of structure:
            740       750       760
     #     789|123456789|123456789|12345
     $ 737 CAGUAGUCCUGAACUAGUAAAUCAGGACC=765
     % 737 :(((:[[[[[[[)))::::::]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-24 PKB00124.html