Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
STNV2_PK2

PKB-number: PKB125
Definition: Pseudoknot PK2 of the 3'-UTR of satellite tobacco necrosis virus 2
Organism: satellite tobacco necrosis virus 2
Abbreviation: STNV2_PK2
RNA type: Viral 3 UTR
Keywords: necrovirus; satellite virus; translational regulation
EMBL number: M64479
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Danthinne X. et al. (1991). Virology 185:605-614.
Stem sizes:
Loop sizes:
3 6
2 0 3
Position Paired:
793-795; 804-806
798-803; 810-815
Bracket view of structure:
                 800       810
     #     23456789|123456789|123456
     $ 792 CCAUUCCCACUAGUGUAUUAGUGGA=816
     % 792 :(((::[[[[[[))):::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-24 PKB00125.html