Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Ec_16S-PK570/866

PKB-number: PKB129
Definition: The pseudoknot 570-571/865-866 of 16S ribosomal RNA of E.coli
Organism: E.coli
Abbreviation: Ec_16S-PK570/866
RNA type: rRNA
Keywords: ribosome; translation; rRNA
EMBL number: E05133
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Gutell R.R. (1993). Curr. Opin. Struct. Biol. 3:313-322.
[2] Van de Peer Y. et al. (1999). Nucleic Acids Res. 27:179-183.
Comment: The pseudoknot was suggested on the basis of phylogenetic comparisons and is conserved in other 16S-like rRNAs: for review see e.g. [1]; the database of small subunit rRNAs [2].
Stem sizes:
Loop sizes:
2 6
249 2 0
Position Paired:
570-571; 865-866
821-826; 874-879
829-840; 846-857
861-862; 867-868
Bracket view of structure:
            570
      #     89|1234 (245)
      $ 568 GCGUAAA=574
      % 568 ::((:::
          820       830       840       850       860       870       880
      #(245)|123456789|123456789|123456789|123456789|123456789|123456789|
      $ 820 UGUCGACUUGGAGGUUGUGCCCUUGAGGCGUGGCUUCCGGAGCUAACGCGUUAAGUCGACC=880
      % 820 :[[[[[[::((((((((((((:::::)))))))))))):::[[::))]]:::::]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-6-24 PKB00129.html