Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
NGF-H1

PKB-number: PKB131
Definition: The pseudoknot of SELEX-isolated ligand H1 to human nerve growth factor
Organism:
Abbreviation: NGF-H1
RNA type: Aptamers
Keywords: SELEX; nerve growth factor
EMBL number:
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; Structure probing
References: [1] Binkley J. et al. (1995). Nucleic Acids Res. 23:3198-3205.
Stem sizes:
Loop sizes:
5 6
2 0 24
Position Paired:
1-5; 14-18
8-13; 43-48
24-29; 36-41
Bracket view of structure:
                 10        20        30        40
     #   123456789|123456789|123456789|123456789|12345678
     $ 1 CGCUCAACUCAUGGAGCGCAAGACGAAUAGCUACAUAUUCGACAUGAG=48
     % 1 (((((::[[[[[[))))):::::((((((::::::)))))):]]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-10-5 PKB00131.html