Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
NGF-L2

PKB-number: PKB132
Definition: The pseudoknot of SELEX-isolated ligand L2 to human nerve growth factor
Organism:
Abbreviation: NGF-L2
RNA type: Aptamers
Keywords: SELEX; nerve growth factor
EMBL number:
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; Structure probing
References: [1] Binkley J. et al. (1995). Nucleic Acids Res. 23:3198-3205.
Stem sizes:
Loop sizes:
5 5
2 0 27
Position Paired:
1-5; 13-17
8-12; 45-49
23-29; 37-43
Bracket view of structure:
                 10        20        30        40
     #   123456789|123456789|123456789|123456789|123456789
     $ 1 CGCUCAACCUCAGAGCGCAAGAGUCGAACGAAUACAGUUCGACAUGAGG=49
     % 1 (((((::[[[[[))))):::::(((((((:::::::))))))):]]]]]

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-10-6 PKB00132.html