Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
CGMMV_PKbulge

PKB-number: PKB140
Definition: tRNA-like structure bulge pseudoknot of cucumber green mottle mosaic virus
Organism: cucumber green mottle mosaic virus
Abbreviation: CGMMV_PKbulge
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: D12505
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Rietveld K. et al. (1984). EMBO J. 3:2613-2619.
[2] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324.
Stem sizes:
Loop sizes:
8 4
4 32 7
Position Paired:
6320-6327; 6368-6375
6336-6341; 6362-6367
6343-6344; 6359-6360
6347-6349; 6355-6357
6332-6335; 6383-6386
Bracket view of structure:
          6320      6330      6340      6350      6360      6370      6380
     #      9|123456789|123456789|123456789|123456789|123456789|123456789|1234567
     $ 6319 UUUGCUCAUUGGUUUGCGGAAACCUCUCACGUGUGACGUUGAAGUUUCUAUGGGCAGUAAUUCUGCAAG=6387
     % 6319 :((((((((::::[[[[((((((:((::(((:::::))):)):)))))))))))))):::::::]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-10-8 PKB00140.html