Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
TMGMV_PKbulge

PKB-number: PKB141
Definition: tRNA-like structure bulge pseudoknot of tobacco mild green mosaic virus
Organism: tobacco mild green mosaic virus
Abbreviation: TMGMV_PKbulge
RNA type: Viral tRNA-like
Keywords: tobamovirus; RNA 3'end
EMBL number: M34077
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; Structure probing
References: [1] Garcia-Arenal F. (1988). Virology 167:201-206.
[2] Mans R.M.W. et al. (1991). Eur. J. Biochem. 201:303-324.
Stem sizes:
Loop sizes:
9 3
4 31 9
Position Paired:
6250-6258; 6297-6305
6267-6271; 6292-6296
6275-6278; 6284-6287
6263-6265; 6315-6317
Bracket view of structure:
          6250      6260      6270      6280      6290      6300      6310
     #      9|123456789|123456789|123456789|123456789|123456789|123456789|12345678
     $ 6249 UUGUCAUAUCUGGAUCCAACAGUUAAACCAUGUGAUGGUGUAUACUGUGGUAUGGCGUAAAACAUCGGAG=6318
     % 6249 :(((((((((::::[[[:(((((:::((((:::::))))::::)))))))))))))):::::::::]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-10-8 PKB00141.html