Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ORSV-S1_PKbulge1

PKB-number: PKB144
Definition: tRNA-like structure bulge pseudoknot of odontoglossum ringspot virus, Singapore isolate
Organism: odontoglossum ringspot virus
Abbreviation: ORSV-S1_PKbulge1
RNA type: Viral tRNA-like
Keywords: tobamovirus; 3'end
EMBL number: U34586
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Chng C.G. et al. (1996). Gene 171:155-161.
[2] Gultyaev A.P. et al. (1994). J. Gen. Virol. 75:2851-2856.
Comment: The 3'-UTR of ORSV RNA contains three (slightly different) upstream pseudoknot domains. The UPD2 and UPD3 include bulge pseudoknot motifs, similar to this pseudoknot in the 3'-terminal tRNA-like structure.
Stem sizes:
Loop sizes:
8 4
4 34 7
Position Paired:
6504-6511; 6554-6561
6520-6523; 6550-6553
6529-6536; 6542-6549
6516-6519; 6569-6572
Bracket view of structure:
                6510      6520      6530      6540      6550      6560      6570
     #      3456789|123456789|123456789|123456789|123456789|123456789|123456789|123
     $ 6503 UUGUGUAUAUGGAUCAUGCGGAUAAAGUUAUACUGGUGCAGUAUAACCCGUUAUACACAUAAAAUUAUGAG=6573
     % 6503 :((((((((::::[[[[((((:::::((((((((:::::)))))))))))))))))))):::::::]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 8-10-1999 PKB00144.html