 |
Intro | ||||
| About PseudoBase | Retrieve by class or by by property | Submit Pseudoknots | |||
 |
ORSV-S1_PKbulge2 |  |
|||
| PKB-number: | PKB145 |
| Definition: | Bulge pseudoknot of the upstream pseudoknot domain (UPD2) of odontoglossum ringspot virus, Singapore isolate |
| Organism: | odontoglossum ringspot virus |
| Abbreviation: | ORSV-S1_PKbulge2 |
| RNA type: | Viral tRNA-like |
| Keywords: | tobamovirus; |
| EMBL number: | U34586 |
| Submitted by: | A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl) |
| Supported by: | Sequence comparison |
| References: |
[1] Chng C.G. et al. (1996). Gene 171:155-161.
[2] Gultyaev A.P. et al. (1994). J. Gen. Virol. 75:2851-2856. |
| Comment: | The 3'-UTR of ORSV RNA contains three (slightly different) upstream pseudoknot domains. The UPD2 and UPD3 include bulge pseudoknot motifs similar to that in the 3'-terminal tRNA-like structure. |
| Stem sizes: Loop sizes: |
5 6 2 23 9 |
| Position Paired: | 6395-6399; 6431-6435 6408-6414; 6424-6430 6402-6407; 6445-6450 |
| Bracket view of structure: |
6400 6410 6420 6430 6440 6450
# 456789|123456789|123456789|123456789|123456789|123456789|1
$ 6394 UUGUGUCAGACGCGUGUAAGGAGUGGUCAACCUUACGACACAUUUAAAUAAUGCGUCC=6451
% 6394 :(((((::[[[[[[(((((((:::::::::)))))))))))):::::::::]]]]]]: