Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
ORSV-S1_PKbulge3

PKB-number: PKB146
Definition: Bulge pseudoknot of the upstream pseudoknot domain (UPD3) of odontoglossum ringspot virus, Singapore isolate
Organism: odontoglossum ringspot virus
Abbreviation: ORSV-S1_PKbulge3
RNA type: Viral tRNA-like
Keywords: tobamovirus;
EMBL number: U34586
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Chng C.G. et al. (1996). Gene 171:155-161.
[2] Gultyaev A.P. et al. (1994). J. Gen. Virol. 75:2851-2856.
Comment: The 3'-UTR of ORSV RNA contains three (slightly different) upstream pseudoknot domains. The UPD2 and UPD3 include bulge pseudoknot motifs similar to that in the 3'-terminal tRNA-like structure.
Stem sizes:
Loop sizes:
5 5
3 14 11
Position Paired:
6292-6296; 6319-6323
6305-6306; 6317-6318
6308-6310; 6314-6316
6300-6304; 6335-6339
Bracket view of structure:
                  6300      6310      6320      6330      6340
     #      123456789|123456789|123456789|123456789|123456789|
     $ 6291 UUUCACUGCGGAUAUGUAGGUUUCCUCGGUGAAUAUAAAACUUAUAUCCC=6340
     % 6291 :(((((:::[[[[[((:(((:::)))))))))):::::::::::]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 8-10-1999 PKB00146.html