Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Sc_18S-PKE21-7/8

PKB-number: PKB147
Definition: The pseudoknot E21-7/8 of 18S ribosomal RNA of S.cerevisiae
Organism: Saccharomyces cerevisiae
Abbreviation: Sc_18S-PKE21-7/8
RNA type: rRNA
Keywords: ribosome; rRNA
EMBL number: J01353
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Neefs J.-M. & De Wachter R. (1990). Nucleic Acids Res. 18:5695-5704.
[2] Van de Peer Y. et al. (1999). Nucleic Acids Res. 27:179-183.
Comment: The pseudoknot has been suggested on the basis of phylogenetic comparisons and is conserved in eukaryotic 18S rRNAs [1]. The database of small subunit RNAs [2].
Stem sizes:
Loop sizes:
10 8
3 0 7
Position Paired:
805-814; 828-837
818-819; 852-853
822-827; 845-850
Bracket view of structure:
               810       820       830       840       850
     #     456789|123456789|123456789|123456789|123456789|1234
     $ 804 AUAAUAGAAUAGGACGUUUGGUUCUAUUUUGUUGGUUUCUAGGACCAUCGU=854
     % 804 :((((((((((:::[[::[[[[[[)))))))))):::::::]]]]]]:]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-15 PKB00147.html