Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
Ec_RNaseP-P4

PKB-number: PKB149
Definition: The P4 pseudoknot of M1 RNA subunit of ribonuclease P
Organism: Escherichia coli
Abbreviation: Ec_RNaseP-P4
RNA type: Ribozymes
Keywords: RNase P; tRNA
EMBL number: K01993
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison; 3D-modelling
References: [1] James B.D. et al. (1988). Cell 52:19-26.
[2] Westhof E. & Altman S. (1994). Proc. Natl. Acad. Sci. USA 91:5133-5137.
[3] Brown J.W. et al. (1996). Proc. Natl. Acad. Sci. USA 93:3001-3006.
[4] Brown J.W. (1999). Nucleic Acids Res. 27:314. (database: http://www.mbio.ncsu.edu/RNaseP/).
Comment: The numbering is given as in the EMBL database entry for the gene: the M1 precursor RNA starts from position 320. The helix P4 (66-74/353-360 in M1 RNA, 385-393/672-679 in the entry) is called P12 in [2]. The structure in conserved in many sequences; for the RNase P database, see [4].
Stem sizes:
Loop sizes:
7 8
47 261 10
Position Paired:
331-337; 655-661
339-340; 379-380
342-347; 372-377
348-351; 367-370
353-357; 362-366
385-387; 677-679
389-393; 672-676
Bracket view of structure:
          330       340       350       360       370       380
      #     |123456789|123456789|123456789|123456789|123456789|
      $ 330 AGACAGUCGCCGCUUCGUCGUCGUCCUCUUCGGGGGAGACGGGCGGAGGGG=380
      % 330 :(((((((:((:((((((((((:(((((::::))))))))):)))))):))
                   390               660       670       680
      #     123456789|1234 (259) 456789|123456789|123456789|
      $ 381 AGGAAAGUCCGGGC=394   UGACUGUCCACGACAGAACCCGGCUUA=680
      % 381 ::::[[[:[[[[[:       :)))))))::::::::::]]]]]]]]:

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-15 PKB00149.html