Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BSMVbeta_UPD-PK1

PKB-number: PKB151
Definition: Pseudoknot PK1 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA beta
Organism: barley stripe mosaic virus
Abbreviation: BSMVbeta_UPD-PK1
RNA type: Viral 3 UTR
Keywords: hordeivirus; translational regulation
EMBL number: X03854
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Pleij C.W.A. et al. (1987). In: "Positive Strand RNA Viruses" (Brinton M.A. & Rueckert P., Eds), Alan R.Liss, Inc., New York, pp 299-316.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
Comment: RNA gamma of BSMV contains similar structure.
Stem sizes:
Loop sizes:
4 7
4 0 3
Position Paired:
3050-3053; 3065-3068
3058-3064; 3072-3078
Bracket view of structure:
           3050      3060      3070      3080
      #      9|123456789|123456789|123456789|
      $ 3049 AAAUGUUUGAUCAGAUCAUUCAAAUCUGAUGG=3080
      % 3049 :((((::::[[[[[[[)))):::]]]]]]]::

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-15 PKB00151.html