Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BSMVbeta_UPD-PK3

PKB-number: PKB153
Definition: Pseudoknot PK3 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA beta
Organism: barley stripe mosaic virus
Abbreviation: BSMVbeta_UPD-PK3
RNA type: Viral 3 UTR
Keywords: hordeivirus; translational regulation
EMBL number: X03854
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Sequence comparison
References: [1] Pleij C.W.A. et al. (1987). In: "Positive Strand RNA Viruses" (Brinton M.A. & Rueckert R., Eds.), Alan R. Liss, Inc., New York, pp 299-316.
[2] Leathers V. et al. (1993). Mol. Cell. Biol. 13:5331-5347.
Comment: RNA gamma of BSMV contains similar structure.
Stem sizes:
Loop sizes:
4 6
4 0 6
Position Paired:
3103-3106; 3117-3120
3111-3115; 3129-3133
3116-3116; 3127-3127
Bracket view of structure:
                  3110      3120      3130
      #      23456789|123456789|123456789|1234
      $ 3102 GAGUGUUUGCAAGUCCACUAUAAUCGAACUUGA=3134
      % 3102 :((((::::[[[[[[))))::::::]:]]]]]:     

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-17 PKB00153.html