Intro
About PseudoBase Retrieve by class or by by property Submit Pseudoknots
BMV3_UPD-PK2

PKB-number: PKB155
Definition: Pseudoknot PK2 of the upstream pseudoknot domain (UPD) of the 3'UTR of RNA3
Organism: brome mosaic virus
Abbreviation: BMV3_UPD-PK2
RNA type: Viral 3 UTR
Keywords: bromovirus; translational regulation; replication
EMBL number: V00099
Submitted by: A.P.Gultyaev ( A.P.Gultyaev@Biology.LeidenUniv.nl)
Supported by: Mutagenesis; Sequence comparison
References: [1] Pleij C.W.A. et al. (1987). In: "Positive Strand RNA Viruses" (Brinton M.A. & Rueckert R., Eds.), Alan R. Liss, Inc., New York, pp 299-316.
[2] Lahser F.C. et al. (1993). J. Virol. 67:3295-3303.
Comment: RNAs 1 and 2 of BMV contain similar structures. Subgenomic RNA4 is derived from RNA3, with the same 3'end.
Stem sizes:
Loop sizes:
3 5
1 0 2
Position Paired:
1865-1867; 1874-1876
1869-1873; 1879-1883
Bracket view of structure:
                1870      1880
      #      456789|123456789|1234
      $ 1864 CCCUUGUCUCAGGUAGAGACC=1884
      % 1864 :(((:[[[[[)))::]]]]]:     

Contact:
© final design and maintenance: F.H.D.(Eke) van Batenburg; 1999-12-17 PKB00155.html